Cavy because it requires little capital, provides quality and

Cavy is a promising livestock especially in sub-Saharan Africa because itrequires little capital, provides quality and cheap meat 31, 16, can be afford by poor people. Cavies are early and prolific 10, 16, when subjected to adequate nutrition and clean environment, theyreproduce rapidly with less health care compared to other species such asrabbits 31,16, and therefore constitute a guarantee of food security 29. In most countries of the Great Lakes regions,cavies are predominantly higher than rabbits or pigs 23, 17. They are well suited to family farming systems where they wouldconstitute with the rabbit the major source of animal protein for family consumption,other species serving as source of income for the household 23, 17, 16.

In eastern DRC, it is currently kept by eight out of ten households,with numbers ranging from 6 to 30 19, 23. This agrees withprevious observations by Schoepf and Schoepf 34, who reported about one third of surveyed households in DRC. Previously consumed exclusively by children,it has become a source of protein for all categories since the 1990s 43, 24. In urban areas, however, consumption remains limited due to theaccessibility and consideration of cavies as an animal of poor 17, 18, 19. In sub-Saharan Africa, despite the benefits of cavyhusbandry in the socio-economic at household level, their population remainspoorly documented, as they are not included in national census except inTanzania 28.

Best services for writing your paper according to Trustpilot

Premium Partner
From $18.00 per page
4,8 / 5
4,80
Writers Experience
4,80
Delivery
4,90
Support
4,70
Price
Recommended Service
From $13.90 per page
4,6 / 5
4,70
Writers Experience
4,70
Delivery
4,60
Support
4,60
Price
From $20.00 per page
4,5 / 5
4,80
Writers Experience
4,50
Delivery
4,40
Support
4,10
Price
* All Partners were chosen among 50+ writing services by our Customer Satisfaction Team

Cavy population in DRC is estimated to be more than 2 million,contributing significantly to nutrition security, especially for animalprotein, and income generation of more than a hundreds of thousands of poorrural and urban households 17. The largest cavy populations arekept in the Kivu provinces, where they are part of ‘rehabilitation kits’ ofhumanitarian NGOs and because they are included in the agricultural portfolioof development agencies who seek to address the challenges of widespread hungerand malnutrition in the area 17. However, despite the role of caviaculturein the household livelihood, their history remains unknown and not documented.Recent research on diversity assessment indicated the existence of three genespools in the country. However there were limitation on gene flow for bettercaption of the genetic diversity that can guide improvement strategies (Ayagirweet al., unpublished data).  Although itis believed that cavies were introduced into Africa by missionaries during thecolonial period. Cavy production system has evolved leading to enormous changesin their production and genetic diversity 22, 25, 29.

The origin of caviesin DR Congo is currently unknown. It is thought that the first cavies were keptin the catholic convents led by Belgian and Italian Jesuit missionaries, aroundearly 20th century when the Catholic Church was established in Bushi area inSud-Kivu 30. However that history relayed on information assembledby word-of-mouth and gathered over decades in discussions with old (± 80 years)key informants from different villages as no known written records exist on thehistory of cavy culture anywhere in DRC 17, as it is the case ofother African countries like Cameroon 48. In this work we proposedto assess the phylogeny and evolution story of cavy raised for meat consumptionin DRC using the very conservative region of the cytochrome b gene. Theobjective of this work was 1) to assess the phylogenetic position of the DRCongo cavies populations, in order to discern if all share a common origin orif they are the result of independent evolutionary events, and 2) to evaluatethe evolutionary affinities among the DRC Cavies and others American andEuropean populations, in order to test previous hypotheses that suggest a closerelationship among them.  1.

    Methodology1.1.       Sampled area    The sampling zone belongs to four different provinces of RD Congo. Locatedon both sides of the Equator, extending between 5° 20′ north latitude and 13°50′ south latitude, between 12° 15’and 31° 15 ‘east longitude. Its naturalenvironment consists of the essential factors that contribute to the qualityand variety of agro-pastoral potential and offer an ecosystem conducive to thepromotion and sustainable development of plant and animal production.

There arefour climatic zones: (i) the equatorial zone at the center, with a warm andhumid climate, temperatures varying between 20°c and 32°C, heavy precipitationexceeding 2,000 mm per year regularly distributed throughout the year; (ii) thetropical zones, with two very marked seasons as one moves away from theEquator.  These are: (a) the rainy season, characterized by precipitationranging from 800 to 1,500 mm per year and fluctuating temperatures between 25°and 33°c; (b) the dry season, which can last from 1 – 3 months in the North andfrom 1 to 6 months (of dry season), in the South, with temperatures rangingfrom 17° to 25°C. (iii) the monsoon climate transition zone, separating humidequatorial and tropical climates, and (iv) the relatively temperate zone in theeastern part of the country with special rainfall conditions (on average 60 mmper month), with temperatures varying between 8°C and 18°c due to the elevationof the relief. The different sampled areas are shown in figure 1. Blood samples werecollected from 96 adults in four provinces of the DRC, 24 samples per region(South and North Kivu, Katanga and Kinshasa) based on their phenotypicvariability, geographic distance location and genetic distance. Blood samplesfrom each animal was collected from ears and stored on FTA cards (Whatman® FTA®card technology, Sigma-Aldrich).

1.2.       Total DNA extractionand PCR amplificationTotal DNA extractionwas carried out at BecA-ILRI Hub using FTA™ Purification Reagent according tothe manufacturer’s protocol. A pairs of primers were designed based on thecytochrome b gene of the cavy reference sequence NC_000884.1 (D’Erchia et al.,1996) deposited in GenBank. Primer pairs were designed (Froward:GCATCTGTCTAGGCCTGCAA and Reverse: GGTTGGCGGGTGTGTAGTTA) to cover variableregions of the cytochrome b gene, with the primers situated in conservedregion. The amplification products ranged from 600 to 670 base pairs aftertrimming.

The PCR amplificationwas done in a 50 µl reaction volume containing 45 ng DNA, 1X AccuPower PCRMaster Mix (Bioneer, Korea), 0.09ng of each primers and 0.5 mM of MgCl2as top up. PCR amplification was performed in a GenAmp ® 9700 PCR systemThermal Cycler (Applied Biosystems) using the following thermal cycling conditions:initial denaturation of 5 min at 95°C followed by 35 cycles of 45s denaturationat 94°C, 60s primer annealing at 58°C and 1 min primer extension at 72 °C, andthen a final extension step of 15 min at 72 °C. PCR product were then evaluatedusing 1.8% agarose gel on electrophoresis. Prior to sequencing, amplifiedproducts were purified using a quick-start protocolof Qiagen Qiaquick® Gel Extraction Kit as recommended by the manufacturer(QIAGEN Inc.

) and visualized on 0.8% agarose gels. Samples were sequenced usingthe BigDye Terminator v3.1 Cycle Sequencing Chemistry (Applied Biosystems) andthe ABI Prism 3130XL automatic capillary sequencer (Applied Biosystems, USA)following the manufacturers recommendations by using the same primers set asdescribed above.1.3.

       Data AnalysisSequences were assembledand trimmed using the CLC Main Work bench 7.8.1. Both strands of all sequenceswere obtained and after blast and conflict resolution, they were free ofindels, premature stop codons and ambiguities in forward and reversedirections, providing support for their mitochondrial origin 40.

Phylogenetic analysesTo evaluate the DRCcavy population phylogeny, two representatives of the Mus famulus, one of theOryctolagus cuniculus and one of the Caprolagus hispidus downloaded from NCBIgenbank were include as outgroup taxa. Ten sequences of wild cavies fromgenbank have been as well used to evaluate the relationship between DRC cavieswith their closely related: Cavia tshudii (2), C. magna (2), C.

fulgida (2), C.apera (2) and C. patzelti (2). However to compare domestic cavies from DRC withother cavy populations, 18 sequences have been downloaded from the NCBI genbank(one from Europe, six from Colombia, five from Peru, two from Chili, three fromBolivia and one from Ecuador). Details for the downloaded sequences are givenin table 1.Multiple alignmentswere first performed and displayed using the Mega6 39, thencarefully examined and manually edited to maximize the overall similarity. TheBayesian Information Criterion were used to describe the best evolutionarymodel for these data. Akaike Information Criterion identified the Kimura 2-parameter model taking into accountthe proportion of invariable sites and following a gamma distribution forvariable sites as most appropriate fit to our data 11 due to its lowest maximum log likelihood (-1195.

4608) and lowestBayesian Information Criterion (4941.856) with the highest Akaike InformationCriterion identified (2855.565). The tree with the highest log likelihood isshown.

The percentage of trees in which the associated taxa clustered togetheris shown next to the branches. Initial tree(s) for the heuristic search wereobtained by applying the Neighbor-Joining method to a matrix of pairwisedistances estimated using the Maximum Composite Likelihood (MCL) approach. Adiscrete Gamma distribution was used to model evolutionary rate differencesamong sites. The tree is drawn to scale, with branch lengths measured in thenumber of substitutions per site. 1000 bootstrap have been used and theanalysis involved a total of 634 positions in the final dataset. Evolutionaryanalyses were conducted in MEGA6 39.2.

    Results2.1.       Phylogenetic relationship between DRC Cavies andtheir relatives wild caviesThephylogenetic tree based on genetic distances and reconstructed by NJ is shown inFig.2.

The topology reported shows three major clusters, one including domesticatedcavies from DR Congo with their closely related Cavia utschudii withrelatively high bootstrap values. One with only Cavia magna (100 bootstrap value) and the third comprising Cavia apera, C. fulgida and C. patzelti although bootstrap supportfor this clade was relatively low (Fig.

2). It appears that the studied DRC cavy population clustered far apart fromthe wild cavies and are only related with C.utschudii (bootstrap value more varying between 80 and 100%). The differentwild cavies are distinctly different from one another based on the length ofthe branches. In DRC population however there is sub-clustering of thedomesticated cavies which shows relatively two groups (bootstrap value = 60%).

 2.2.       DRC Cavy populationphylogeny compared to their clothier taxaThe figure 3, basedon genetic distances and reconstructed by NJ, it indicates that there is threeclusters. A clear differentiation is observed between cavy populations from DRCand two others clusters comprising of the Musfamulus and the Oryctolagus cuniculusclustered with Caprolagus hispidus. However on that phylogeny treeit appears that cavy populations are more clothier to mouse than they do forrabbit.

  All the cavies from DRCclustered in a unique big cluster with 99% bootstrap value. Between the DRC cavypopulation cluster, there is existence of sub-clustering. However, thatclustering is not due to cavy population origin. Some individuals from Kinshasaclustered far apart from the rest of the group with 60% bootstrap value. Theexistence of the admixture of cavy individuals from different regions impliesthe evidence of sharing the same genetic background and the exchange at acertain level of the genetic materials. The low genetic distance exitingbetween these populations. 2.3.

       DRC Cavy populationrelationship compared to other Latin American domesticated cavy populationsThe history of cavy introduction in DR Congo is not known.Their origin is however speculated as well as the introduction anddissemination route. It is believed that they came from South America but thereal country of origin is not yet clearly established. We considered caviesfrom six Latin American countries (Peru, Colombia, Chili, Ecuador, Bolivia andArgentina) and from Europe to trace the dissemination route and probablecountry of origin. From the figure it appears that all DRC cavies wereclustered with a pet cavy form Argentina and Europe as well as with someindividuals from Peruvian domestic cavy (with 66% confidence). The secondcluster belongs to cavies from Colombia which are as well clothier to DRCcavies than the rest do.

Some sequences of cavies from Chili, Bolivia, Peru andColombia clustered together and are the one very distant from the DRC sequences.Possible existence of high genetic diversity exist in South America populationand only a narrow genetic material have moved to Europe during the immigration.As it have been shown previously, the European specimens clearly originate fromSouth America; and suggestion that European cavies either originate from theCaribbean or possibly directly from Colombia and Peru. It is as well clear thatcavies transited from Europe before introduction to Africa.

The presence ofArgentina pet in the same cluster of DRC cavies and Europe is in accordancewith the migration purpose of cavy as laboratory and pet animal than the actualuse it deserve in Africa as source of meat for consumption. 2.4.       DiscussionCavies are reported to have been domesticated at least 4.500years ago 33 in the highlands of South America providing the Indianswith meat and sacrificial animals. However, opinion still dived on the realancestor of Cavia porcellus as twowild cavy were known to be related; C.apera and C. utschudii.

These twowild cavies are known to reproduce with the domesticated cavies fertileoffspring 12,13. Kruska and Steffen 12 observed when doing comparative allometric investigationson the skulls of wild cavies (Caviaaperea) versus domesticated cavies (C.porcellus) that C. apera is theancestor of the domesticated cavies. “Caviatschudii” mainly distributed in Peruand Chile being considered as a subspecies of the species Cavia aperea, which is widely distributed on the South Americancontinent. This have been based on configuration of the upper M3 occlusalsurface of all the wild Cavia apereaincluding those from Andean regions but also from far northern and far easterndistribution as well as of the domesticated cavies. When comparing chromosome 15, 45 as well as DNA investigations 41, these different authors suggested the origin ofdomesticated cavies from Cavia aperea.

However, Recently Spotorno et al. 38, 35, 36 revitalized older assumptions, when investigating theorigin of domesticated cavies by use of molecular genetic methods as well asskull measures and some other morphological traits. As a result they derivedall domesticated cavies from a species Caviatschudii with a distribution in the East Andean regions of Peru andnorthern Chile rather than from the species Caviaaperea of adjacent Bolivia.In this study, domesticated cavies from DRC clustered with C. utshudii and far apart from C. apera while using cytochrome b genesequences.

However phylogenetic inference determined that Cavia porcellus species share hereditary characteristics with paraphyletic group Cavia tschudii and Cavia aperea animals confirming Cavia porcellus offspring from Cavia tschudii 9.The history of cavy introduction in DR Congo is not known.Their origin is however speculated as well as the route of introduction.

It isbelieved that they came from South America but the real country of origin isnot yet clearly established. Two possible introduction to Africa are reported;Blench 4, assumes that they have only been introduced by Christianmissionaries and colonial agricultural officers. Whereas Morales 26 suggests that the misnomer ‘Guinea pig’ may have inferredfrom the Europeanassumption that cavies came from theWest African coast of Guinea after being imported from South America via theGuinea slave trade ships. From this study, it appears that all DRC cavies wereclustered with a pet cavy from Argentina and Europe as well as with someindividuals from Peruvian domestic cavy. It is there clearly showed that domesticatedcavies in DRC were most likely from Peru and Colombia and have transited byEurope before their introduction in Africa. This would suggest as well variousintroduction of animals from the two countries. However, depending on theirsmall size characteristics they still comparable with their closely relatedcavies (Criollos) which still be founded in rural areas in Latin America.

Thepresent South American populations are probably the descendants ofpre-Columbian lineages. Whether Andean and laboratory/pet breeds aregenetically distinct is uncertain 37.However Cavia porcellus have beenwell-known domestic pets since their introduction to Europe in the sixteenthcentury, from undocumented sources 46, 47; they became the prototype of laboratory models through thenineteenth century 44.

However they probably had a recent common ancestor aroundthe sixteenth century 44. In fact, molecular analyses of Peruvian cavies breeders 7 differentiate with the prolific, large-sized caviesexhibiting a calm behavior (improved cavies), and the small-sized, nervous ones(the “criollos” = creoles), typically found in rural houses 1, suggestthat improved cavies share a most recent common ancestor with the European cavywhich is not the ancestor of creoles 36.Cavies brought to Europe were then subjected to further selective breedingleading to the common domestic form that is nowadays used as pets andlaboratory animals 38. Their wild relative, the wild cavy (Cavia aperea) still is one of the most common and widespreadrodents of South America 2, 32.Domesticated cavies follow a three-step process 38: a first ancient domestication 46, from the wild species to the domestic pre-Columbian cavy,still bred as the ‘criollo’ (creole) breed throughout the Andean countries; asecond step involving European peoples, who took a few in the XVI century andtransformed them into the present worldwide laboratory/pet cavy 36; and a third step involving a modern selection regime ofcreole cavies 7, to produce an improved animal for meat production known inSouth American countries 26. This have been made possible, in recognition that caviescan reproduce up to five generations per year 42 and concerning the length of the domestication period theythus have lived under this influence for much more generations than have theother domesticated lagomorphs and rodents and even than the other so?called classical domesticated forms (e. g., dog, sheep,goat, cattle, pig, etc.

13) which led to very different cavies categories. From Europecavies have been then introduced to Africa during precolonial period. However in DRC, the period of that introduction stillunknown. It has been conveyed that the first cavies were held in the catholicconvents in Sud-Kivu, led by Belgian and Italian Jesuit missionaries, probablystarting around the early 20th century, when the Catholic Church establisheditself in the Bushi area 30. In the early colonial period, local people had no specificinterest in cavies.

Though, some of those working in the convents introducedthe animal into their villages 27,probably to supply meat to their children. Many people, however, thought cavieswere a kind of rat and, hence, adults scorned their children’s animal insidethe houses.However, the chaos caused by the succession war for theMwami Kabare (1985-1987) resulted in widespread famine and high levels ofmalnutrition, especially in children 21.Then, cavies became considered as a ‘medical treatment’ for malnutrition,particularly in overcoming anemia 27.

Some NGOs, such as Comité Anti-Bwaki5, recommended that children received cavyblood, mixed with Coca Cola and tomato concentrate to overcome the condition.The belief that cavy blood and meat has a health-improving effect especiallyfor children perpetuates until today, also in other parts of the country (BKajinga-Mutombo, pers. comm.

).In a survey conducted in the early 1980s in four mountainouslocalities in Kabare territoire of Sud-Kivu near Mulungu, Schoepf and Schoepf 34 found that in one third of the 160 households visited,older children raised cavies, which they consumed. This has to be seen in thecontext where mothers usually leave starchy staples prepared in the home beforethey leave to the fields; when children return from school, they prepare cavystew by themselves. The importance of cavy culture at that time in Kabareterritoire have been recognized based on its prevalence and its reportedcontribution to animal-source protein provision for children 14.

Cavies are described to be omnipresent in Mulambagroupement in Walungu territoire, the large majority (83%) of 40 interviewedhouseholds from four villages kept cavies successfully for a long time, meaningat least since independence in the 1960s 27.All DRC cavies were clustered in only one group with lessdifferentiation. When establishing a nucleus of cavies for a selection programin the Institut supérieur agro-vétérinaire in Mont-Ngafula in Kinshasa in 2008,populations were introduced from the Kivu provinces, Lubumbashi and differentvillages and cities in the Bas-Congo province, such as Kimpese and Kisantu.Strong cavy nuclei seem to thrive unnoticed in all these areas as very fewofficial reports are to be found that mention cavies 17. This movement of animal may be one of the raisons why DRCcavy are closely related.

3.    ConclusionThe studied caviesfrom DRC were less differentiated due to the animal exchange and geneticintrogression. The phylogenetic tree confirmed the hypothesis of C.

utschudii being the ancestor ofdomesticated cavies. The most plausible road of dissemination of cavies wereLatin America to Africa via Europe and not the direct introduction. Caviestransited in Europe with the purpose of research and pet before being used asmeat source in Africa. That road of dissemination may reflect as well the geneflow and would be tracked in improvement process. Possible existence of high genetic diversity exist in SouthAmerica population and only a narrow genetic material have been introduced toDRC via Europe during the immigration.4.   AcknowledgementsWe acknowledge the Biosciences eastern and central Africa -International Livestock Research Institute (BecA-ILRI) Hub, through AfricaBiosciences Challenge Fund (ABCF) program for funding this work. The ABCFProgram is funded by the Australian Department for Foreign Affairs and Trade(DFAT) through the BecA-CSIRO partnership; the Syngenta Foundation forSustainable Agriculture (SFSA); the Bill & Melinda Gates Foundation (BMGF);the UK Department for International Development (DFID) and; the SwedishInternational Development Cooperation Agency (Sida).

The BESUP from the Eglisedu Christ au Congo (ECC) for supporting financially the field work. We thank aswell all cavy owners in DR Congo for providing unreserved access to theiranimals for sampling.